rs12047281 chr1:236998167 C>T
- Sequence
gggccctccctggccaccactgtt[C/T]gggattcagttcttgtttctgttg
- ASB in cell types
- HEK293T (embryonic kidney) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 1.23 | -0.41 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.86 | -0.73 | 3.82 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adolescent idiopathic scoliosis, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hypertension (early onset hypertension), parkinsons disease, triglycerides change with statins