rs12062498 chr1:168637645 G>A
- Sequence
gcatttaaggcaatgatatctttt[G/A]cgtctcacaactcctctttcttta
- ASB in cell types
- HEK293 (embryonic kidney) HeLa S3 (cervical adenocarcinoma) foreskin keratinocyte VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.32 | 0.89 | 2.01 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.34 | 1.35 | 1.37 | |||
| foreskin keratinocyte | 0.43 | n/a | 2.00 | |||
| VCaP (prostate carcinoma) | 1.99 | 0.12 | 2.00 |
Items per page:
1 – 4 of 4