rs12087113 chr1:233140820 G>C
- Sequence
cccaacttgaggagagcacagcag[G/C]ttcaggcccagggccctcggctag
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -0.85 | 1.43 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1