rs12094766 chr1:87370872 T>C
- Sequence
aatatatgggggacagccagatgt[T/C]ggtggcctctcagttccttgtctc
- ASB in cell types
- monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | 1.68 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, partial epilepsy, total cholesterol, type 2 diabetes, combined control dataset, variant creutzfeldt-jakob disease