rs12106105 chr20:9344431 G>A
- Sequence
attttcttcctctgtctgcaggac[G/A]gcactgttctgttcactgctgtat
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.09 | 0.29 | 1.47 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), fasting insulin, homa-b, homa-ir, ldl cholesterol, total cholesterol, total cholesterol change with statins