rs12112909 chr7:124944780 C>T
- Sequence
ttttgagacttgatgccgtctatg[C/T]caacatctatgtcaatatgtcagc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | n/a | 2.94 | 1.33 | 1.49 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, stabilized warfarin dose, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Hippocampus, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Spleen, Thyroid