rs12120313 chr1:227564673 A>C
- Sequence
tactccaggcacaatattttaatt[A/C]atcattttttcacagaacattgga
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.58 | 0.86 | 3.77 | |||
| HEK293T (embryonic kidney) | -0.27 | 0.95 | 2.08 |
Items per page:
1 – 2 of 2