rs12123324 chr1:70909592 C>T
- Sequence
aagctcctcaagtgttagagttca[C/T]aagatgttgggtaactgtacagtt
- ASB in cell types
- MOLT3 (adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.99 | -1.91 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, hypertension (early onset hypertension), neuroblastoma (brain cancer), obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease, triglycerides, years of education