rs12126307 chr1:62746576 G>C
- Sequence
caagtgtgtttacaactgtgaatg[G/C]taaatcccaccagaagaaaggcaa
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.70 | -0.18 | 1.99 | |||
| HEK293T (embryonic kidney) | 0.34 | 0.81 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood