rs12129468 chr1:153849468 T>A
- Sequence
tatctaacaggcattttataatct[T/A]atgtccaaaattgtttcttcccct
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.60 | 0.57 | 1.29 | |||
| K562 (myelogenous leukemia) | -0.17 | 0.47 | 2.06 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood