rs12137025 chr1:223684349 T>C
- Sequence
gcgacagcagtcagaggtaactca[T/C]gttaaaggtatcagtgatggctcc
- ASB in cell types
- spleen MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) uterus
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 1.44 | -1.31 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.76 | -0.11 | 1.86 | |||
| GM12878 (female B-cells) | 0.70 | 0.55 | 1.28 | |||
| uterus | 1.85 | -1.65 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Spleen, Thyroid, Uterus