rs12139863 chr1:70168902 G>C
- Sequence
gacacaacataccaaaacgtatga[G/C]ctgtagataaagccatgcttagag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.35 | 0.57 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid, Whole_Blood