rs12140369 chr1:53582209 A>T
- Sequence
tggctccatgcaaatgaagaaagg[A/T]ggctggcagagccaggcagtggaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.04 | -0.42 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, second to fourth digit length ratio, second to fourth digit length ratio (right hand), triglycerides