rs12140898 chr1:206673255 T>C
- Sequence
aagcagcttctagaacttgtgatc[T/C]ttcaaccttatttttatgcccaag
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia) periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN BCL6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.47 | 0.19 | 1.97 | n/a | No Hit | |||
| BCL6_HUMAN | 1.81 | -3.49 | 2.25 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir, resistance to kuru in aged women despite likely exposure, suicide attempts in bipolar disorder (males), triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Thyroid