rs12143943 chr1:204602943 G>A
- Sequence
gccatgttctgggtgctagggaaa[G/A]aagtggacaagactctgctctctt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.72 | 1.15 | 2.65 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, college completion, hip bone mineral density (bmd), ldl cholesterol change with statins, paired associates learning total errors 8 patterns, pc1 principal components analysis of performance on cambridge neuropsychological test automated battery, spatial working memory strategy, total cholesterol change with statins, years of education
PheWAS acid-base balance disorder, acidosis, acute appendicitis, adrenal hypofunction, anomalies of jaw size/symmetry, bundle branch block, carbuncle and furuncle, cardiac shunt/ heart septal defect, congenital anomalies of posterior segment of eye, congenital anomalies of the eye, contracture of joint, disorders of cervical region, disorders of sweat glands, duodenitis, elevated c-reactive protein, elevated sedimentation rate, erectile dysfunction, genu valgum or varum (acquired), heartburn, hematemesis, hypoparathyroidism, infections involving bone, keratoconjunctivitis sicca, mitral stenosis/insufficiency, muscle weakness, noninflammatory disorders of cervix, other acquired musculoskeletal deformity, other arthropathies, other disorders of lipoid metabolism and hyperalimentation, parasomnia, peritonitis and retroperitoneal infections, phlebitis and thrombophlebitis, phlebitis and thrombophlebitis of lower extremities, postmenopausal bleeding, postnasal drip, renal failure nos, reticulosarcoma, symptoms associated with female genital organs, toxic effect of venom, unspecified osteomyelitis