rs12144187 chr1:67532523 A>G
- Sequence
tggcaccaagttgttccttaatag[A/G]gggaaactgttatgatggcggaag
- ASB in cell types
- K562 (myelogenous leukemia) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | -0.29 | 1.91 | |||
| hepatocytes | 0.93 | -0.48 | 1.22 |
Items per page:
1 – 2 of 2