rs12144894 chr1:89567239 T>C
- Sequence
tttcattcttccaacttggtactt[T/C]tatgttttgctaaggaggaagaaa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.65 | -0.14 | 1.93 | |||
| HEK293 (embryonic kidney) | -0.18 | 0.58 | 1.98 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Spinal_cord_cervical_c-1, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood