rs12146628 chr11:104332242 G>C
- Sequence
cttattcagactatgaagaaccag[G/C]gtctaactacgttcacattactgg
- ASB in cell types
- epithelial cell of prostate Peyer's patch H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.53 | 1.73 | 1.00 | |||
| Peyer's patch | n/a | 2.02 | 1.33 | |||
| H929 (plasma cell myeloma) | n/a | 2.27 | 3.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Nerve_Tibial