rs12147431 chr14:70084384 G>A
- Sequence
agtgtctgctgttgtcaaccttct[G/A]gggcttgaggatagaaatcctgtg
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- GATA1_HUMAN TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.33 | -2.70 | 1.50 | n/a | No Hit | |||
| TAL1_HUMAN | 1.99 | -2.41 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, parkinsons disease, total cholesterol change with statins, triglycerides change with statins