rs12147672 chr14:105196850 G>A
- Sequence
tccctccttcgcggcctgggcctc[G/A]gcaggtgcggccgggactcgggac
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 0.96 | -0.19 | 1.33 | -0.13 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Thyroid