rs12148488 chr15:75090201 G>T
- Sequence
ccctcctgcccttttgtaagacac[G/T]aatcccatccatgaggacagagcc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.31 | 0.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, bipolar disorder, coffee consumption, coronary artery disease (cad), diastolic blood pressure (dbp), habitual caffeine consumption, habitual caffeine consumption (female), habitual caffeine consumption (male), habitual caffeine consumption (never smokers), ldl cholesterol, myasthenia gravis, refractive error, systolic blood pressure (sbp), total cholesterol
PheWAS acute appendicitis, acute pharyngitis, adverse effects of cardiac rhythm regulators, appendiceal conditions, appendicitis, atherosclerosis of aorta, atrophy of edentulous alveolar ridge, attention deficit hyperactivity disorder, benign neoplasm of respiratory and intrathoracic organs, benign neoplasm of thyroid glands, calculus of bile duct, calculus of lower urinary tract, cancer of other female genital organs, cardiac shunt/ heart septal defect, central/nonobstroctive sleep apnea, chronic rheumatic disease of the heart valves, circulatory disease nec, congenital musculoskeletal deformities of spine, disorders of other cranial nerves, disorders of parathyroid gland, displacement of intervertebral disc, early complications of trauma or procedure, effects of radiation nos, endometrial hyperplasia, esophageal cancer, facial nerve disorders, gram positive septicemia, hallux valgus (bunion), hyperventilation, hypotension, impetigo, kidney replaced by transpant, lyme disease, noninfectious dermatoses of eyelid, obesity, orchitis and epididymitis, other congenital anomalies, other disorders of circulatory system, other specified disorders of plasma protein metabolism, overweight, pagets disease of bone, pain, swelling or discharge of eye, pancreatic cancer, paralytic ileus, periostitis, peritonitis and retroperitoneal infections, phlebitis and thrombophlebitis of lower extremities, pituitary hypofunction, polycythemia vera, posttraumatic stress disorder, prostate cancer, rash and other nonspecific skin eruption, sialoadenitis, somatoform disorder, spirochetal infection, temporomandibular joint disorders, varicose veins of lower extremity
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood