rs12150079 chr17:39869164 G>A
- Sequence
cccccaaccaaattgtaggacgtt[G/A]tctttatgagcctggcattcagta
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.49 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), asthma, asthma (childhood asthma), asthma, childhood and later onset, asthma, childhood onset, asthma, childhood, later and unknown onset, and severe and industrial asthma, asthma, childhood, later and unknown onset, and severe asthma, barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), chronic kidney disease, college completion, hdl cholesterol, irritible bowel syndrome, ldl cholesterol, microalbuminuria, multiple myeloma, serum creatinine, severe asthma, tardive dyskinesia, transmission distortion, type 1 diabetes, type 1 diabetes, combined control dataset, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood