rs12150452 chr17:50401667 C>A
- Sequence
attttgctccgggcctaaggtgga[C/A]ttccgaagttttttttttaatgtc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- REQU_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | -1.17 | 1.94 | 2.00 | n/a | n/a | |||
| SMCA4_HUMAN | -0.45 | 1.88 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood