rs12155001 chr7:70716549 C>T
- Sequence
cgggaagctgaggcaggagaatgg[C/T]gtgaacccggccgggaggcagagc
- ASB in cell types
- epithelial cell of prostate LNCaP (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.30 | 1.30 | 1.00 | |||
| LNCaP (prostate carcinoma) | 1.57 | -0.89 | 1.17 | |||
| 22RV1 (prostate carcinoma) | -1.92 | 2.25 | 2.00 |
Items per page:
1 – 3 of 3