rs12155668 chr8:18067642 C>T
- Sequence
ctaacctgacccacaccacaaaaa[C/T]atcataacaagcactccttatctc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.68 | 2.79 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, height, ldl cholesterol, partial epilepsy, premature ovarian failure, prop taste detection threshold, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Thyroid, Whole_Blood