rs12166817 chr22:39350419 C>A
- Sequence
gtgacctccaggccgcggctatgc[C/A]gcgaaaggctcggattgtgcgcgg
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PATZ1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | n/a | 2.55 | 2.00 | -2.08 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood