rs12167477 chr22:20285918 G>A
- Sequence
gccctctgctgccctctgccggcc[G/A]cctctgtccctgcaggcccagcca
- ASB in cell types
- upper lobe of left lung tibial nerve vagina HCT-116-RAD21-mAC
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.14 | 0.27 | 1.83 | 0.33 | Weak Discordant | |||
| RAD21_HUMAN | 1.56 | 1.05 | 1.47 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
