rs12174754 chr6:166275744 G>A
- Sequence
acacagcctggggtatctctgttc[G/A]ttcgtgctggttacccagggcagg
- ASB in cell types
- foreskin keratinocyte erythroid cells PC9 (lung adenocarcinoma) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.61 | n/a | 2.33 | |||
| erythroid cells | 2.45 | -3.72 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.78 | -0.57 | 2.00 | |||
| neutrophils | 2.15 | 0.41 | 1.50 | |||
| liver | 1.67 | -1.30 | 1.33 |
Items per page:
1 – 5 of 7