Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs12176317 chr6:26372558 A>G

Sequence
catggagggagggaggacagggtg[A/G]atgagagagttgcgtgactttatg
ASB in cell types
K562 (myelogenous leukemia)

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
K562 (myelogenous leukemia) -0.56 1.01 1.003.9·10-19 2.97
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

GRASP advanced age-related macular degeneration advanced age-related macular degeneration (choroidal neovascularization) vs. no amd bipolar disorder hdl cholesterol idiopathic membranous nephropathy infant head circumference longstanding arthritis lung function, forced expiratory volume in 1 second (fev1) myopia response to chronic hepatitis c interferon-alpha and ribavirin therapy rheumatoid arthritis schizophrenia serum creatinine spine bone mineral density (bmd) tetrology of fallot
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Amygdala Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Brain_Substantia_nigra Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Kidney_Cortex Liver Lung Minor_Salivary_Gland Muscle_Skeletal Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Uterus Vagina Whole_Blood

Download