rs12185469 chr18:731442 C>A
- Sequence
aaagtgggtgataaaatttgatgg[C/A]attagatctacagctggagggaac
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- ARI1B_HUMAN GATA1_HUMAN NCOR1_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | n/a | 1.10 | 1.33 | n/a | n/a | |||
| GATA1_HUMAN | 2.30 | 1.00 | 1.78 | n/a | No Hit | |||
| NCOR1_HUMAN | -1.74 | 1.39 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | -1.39 | 1.80 | 1.33 | n/a | No Hit | |||
| REQU_HUMAN | -1.16 | 1.61 | 1.17 | n/a | n/a |
Items per page:
1 – 5 of 11
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood