rs12190570 chr6:37890911 G>T
- Sequence
tgactctagccaaatggcagagca[G/T]gcagctccaaacacactaatctct
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -2.88 | 1.58 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg