rs12199222 chr6:17699091 G>T
- Sequence
atcatcctgtttctgacagtaaat[G/T]gtatgtgtcagcaagacttgaaac
- ASB for transcription factors
- EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EMSY_HUMAN | n/a | 2.00 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, arthritis including non-rheumatoid, eye color, height, longstanding arthritis, lp-pla2 activity, stabilized warfarin dose, total cholesterol, triglycerides
PheWAS abdominal aortic aneurysm, abnormal kidney function, abnormal mammogram, abnormality of gait, acute renal failure, alzheimers disease, anal and rectal polyp, aortic aneurysm, atherosclerosis of renal artery, atrophy of edentulous alveolar ridge, benign neoplasm of lip, oral cavity, and pharynx, bladder neck obstruction, brain cancer, cancer of brain and nervous system, cancer of larynx, carbohydrate transport and metabolism disorder, cardiac dysrhythmias, cellulitis and abscess of foot/toes, cholelithiasis with other cholecystitis, chronic laryngitis, chronic venous insufficiency, colostomy and enterostomy complication, conductive hearing loss, delirium dementia and amnestic disorders, delirium due to conditions classified elsewhere, dementias, dermatomycoses, dermatophytosis of the body, disaccharide malabsorption, discoid lupus erythematosus, diseases of the jaws, diseases of the larynx and vocal cords, esophageal cancer, fracture of vertebral column without mention of spinal cord injury, frequency of urination and polyuria, gangrene, history of diseases of digestive system, infection/inflammation of internal prosthetic device, implant or graft, inflammatory disease of cervix, vagina, and vulva, injuries to the nervous system, jaw disease nos, lipoprotein disorders, malignant neoplasm of renal pelvis, malunion fracture, mastoiditis, melanoma, nasal polyps, nephritis and nephropathy in diseases classified elsewhere, nephritis and nephropathy without mention of glomerulonephritis, nephritis, nephrosis, renal sclerosis, noninfectious disorders of lymphatic channels, other aneurysm, other disorders of bladder, other disorders of lipoid metabolism and hyperalimentation, other disorders of tympanic membrane, otitis media, perforation of tympanic membrane, peripheral arterial disease, renal osteodystrophy, retention of urine, retinal drusen, severe protein-calorie malnutrition, spermatocele, spondylolisthesis, congenital, streptococcus infection, superficial cellulitis and abscess, symptoms involving female genital tract, systemic lupus erythematosus, type 1 diabetes nephropathy, type 2 diabetic nephropathy, type 2 diabetic neuropathy, ulceration of intestine, urinary complications, urticaria, vaginitis and vulvovaginitis, voice disturbance, wheezing
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood