rs12202510 chr6:71534152 C>A
- Sequence
taaattttgtcaggaattacagag[C/A]tactattattaataaaatatatta
- ASB in cell types
- LNCaP (prostate carcinoma) bipolar neuron foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.48 | 1.55 | 1.50 | |||
| bipolar neuron | -0.85 | 0.85 | 1.00 | |||
| foreskin keratinocyte | 0.99 | n/a | 2.33 |
Items per page:
1 – 3 of 3