rs12204199 chr6:71510453 G>C
- Sequence
gcaacagcacgatcaactgaagtc[G/C]ggattgccagtaattgccaattcc
- ASB in cell types
- LNCaP (prostate carcinoma) foreskin keratinocyte H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -1.29 | 1.68 | 1.50 | |||
| foreskin keratinocyte | 1.34 | -2.51 | 2.33 | |||
| H929 (plasma cell myeloma) | n/a | 1.86 | 1.50 |
Items per page:
1 – 3 of 3