rs12210301 chr6:142845933 G>A
- Sequence
gactggggacagccacttgtggct[G/A]agacaaaggcaggctccccctgcc
- ASB in cell types
- Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 1.34 | -1.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, fasting blood glucose, hdl cholesterol, years of education