rs12215726 chr6:77834671 G>A
- Sequence
tgtaaacagttgccactgggcccc[G/A]atcagatagtgaggctcacattta
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 1.99 | -0.17 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1