rs12230440 chr12:1747787 T>G
- Sequence
cattgtttctgcttagaagtcagc[T/G]gctaatcttactgggttccatttt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.04 | -0.31 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol, hip bone mineral density (bmd), longstanding arthritis, mitral annular calcium, partial epilepsy, phenytoin-induced hypersensitivity, spine bone mineral density (bmd), years of education
PheWAS acne, acquired absence of breast, acute posthemorrhagic anemia, adverse effects of adrenal cortical steroids, alcoholism, anisometropia, behcets syndrome, bursitis, cancer of larynx, cancer of oropharynx, cancer, suspected or other, dental caries, diseases of hard tissues of teeth, diverticulum of esophagus, acquired, gastroparesis, glossitis, glycosuria or acetonuria, hematuria, history of diseases of digestive system, hydrocele, hypothyroidism, kidney replaced by transpant, malignant neoplasm, other, mitral stenosis/insufficiency, mucous polyp of cervix, multiple myeloma, nerve root lesions, obstruction of bile duct, open wound of nose and sinus, open wounds of extremities, osteopenia, osteoporosis, osteoporosis, nos or other, osteoporosis, osteopenia, & pathological fractures, other anemias, other conditions of the mother complicating pregnancy, other disorders of circulatory system, other disorders of pancreatic internal secretion, other disorders of testis, other hypertensive complications, other specified disorders of pancreatic internal secretion, other specified disorders of plasma protein metabolism, other symptoms referable to back, peyronies disease, poisoning by hormones and synthetic substitutes, postmenopausal atrophic vaginitis, postmenopausal hormone replacement, protein-calorie malnutrition, pseudomonal pneumonia, renal dialysis, secondary malignancy of lung, spermatocele, stress incontinence, female, subarachnoid hemorrhage (injury), subdural hemorrhage, symptoms involving respiratory system, thyroid cancer, thyrotoxicosis, type 2 diabetic neuropathy, varicose veins, varicose veins of lower extremity, varicose veins of lower extremity, symptomtic, viral infection
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Nerve_Tibial, Thyroid, Whole_Blood