rs12234926 chr8:54457037 A>C
- Sequence
tctaaagaaacttatagaaatcta[A/C]ttatctgccagaataaccgcttta
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 0.47 | 1.35 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP common carotid artery thickness (average of near and far wall measures), internal carotid artery thickness (average of near and far walls)