rs12236963 chr9:10252326 T>A
- Sequence
atctccatctctatctcttcttgc[T/A]gttggaatccagtcaccatgctgt
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -2.10 | 2.47 | 1.67 | 1.31 | Weak Concordant | |||
| TAL1_HUMAN | -1.83 | 1.96 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
