rs12258159 chr10:101095883 G>A
- Sequence
atgcctttgggaaggtgggaatcc[G/A]ccagcggagggtgatggggagtgg
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.17 | 0.55 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.25 | -1.95 | 2.00 | |||
| HCT-116 (colon carcinoma) | 1.39 | -0.83 | 1.90 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Small_Intestine_Terminal_Ileum