rs1226187 chr1:92113649 A>G
- Sequence
caggaagtagcttctggtgagatg[A/G]ccttgtgacctaggtggaataaat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MEIS2_HUMAN COT1_HUMAN ARI1B_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | 2.86 | n/a | 2.00 | n/a | No Hit | |||
| COT1_HUMAN | 2.91 | n/a | 2.00 | n/a | No Hit | |||
| ARI1B_HUMAN | 2.34 | n/a | 2.00 | n/a | n/a | |||
| NR2C1_HUMAN | 2.24 | n/a | 1.50 | -3.96 | Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP chronic kidney disease, college completion, infant head circumference, rheumatoid arthritis, total cholesterol, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid