rs12264286 chr10:46266429 T>C
- Sequence
atcaggagcagcagaaagagaccc[T/C]gagggggaggggagctctctactc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.02 | -0.19 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood