rs12269028 chr10:45000672 A>T
- Sequence
taccagggtctcaaaaatctcaaa[A/T]tttgtggaaagtatgcagtttcta
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.54 | 0.39 | 1.39 | |||
| GM12878 (female B-cells) | 0.31 | 0.55 | 1.27 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid