rs12270217 chr11:4187787 T>G
- Sequence
ccgacagcagcagtcgagcgcggg[T/G]gcgccactctgaccgccgctcgct
- ASB in cell types
- neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 1.94 | -1.24 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Heart_Atrial_Appendage, Nerve_Tibial