rs12283429 chr11:124770375 T>C
- Sequence
cccaggctggaatgcatgactcac[T/C]ggagctttgacctcccagactcaa
- ASB in cell types
- HT29 (colon adenocarcinoma) coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | 1.50 | -0.99 | 3.00 | |||
| coronary artery smooth muscle | -0.73 | 0.99 | 1.33 |
Items per page:
1 – 2 of 2