rs12295638 chr11:26583784 T>C
- Sequence
tgaggatgatgctgaaaataaacc[T/C]ggggaatggaggagtcttaagtag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.01 | 0.59 | 1.85 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, extreme obesity (body mass index (bmi)), hdl cholesterol, psoriasis, total cholesterol
PheWAS acquired deformities of ankle and foot, acquired foot deformities, acquired toe deformities, acute osteomyelitis, adverse effects of antibacterials (not penicillins), adverse effects of antirheumatics, adverse effects of hormones and synthetic substitutes, adverse effects of sedatives or other central nervous system depressants and anesthetics, amblyopia, anaphylactic shock nos, ascvd, atrophic gastritis, breast cancer, breast cancer, including in situ, chronic rheumatic disease of the heart valves, cns infection and poliomyelitis, cornea replaced by transplant, cystitis, cystitis and urethritis, delirium dementia and amnestic disorders, dementia with cerebral degenerations, dementias, disorders of function of stomach, dyspepsia and disorders of function of stomach, e. coli, fuchs dystrophy, functional digestive disorders, gastritis and duodenitis, nos, hallucinations, hypotension nos, iatrogenic hypothyroidism, infections of kidney, insulin pump user, intestinal infection due to c. difficile, irritable bowel syndrome, keratitis, lesions of stomach and duodenum, male genital disorders, nephritis & nephropathy, nephritis and nephropathy without mention of glomerulonephritis, noninflammatory disorders of vulva and perineum, osteoarthrosis, localized, secondary, other disorders of eyelids, other disorders of testis, other headache syndromes, other specified disorders of plasma protein metabolism, personal history of allergy to medicinal agents, phlebitis and thrombophlebitis of lower extremities, pituitary hypofunction, poisoning by analgesics, antipyretics, and antirheumatics, primary angle-closure glaucoma, schizophrenia and other psychotic disorders, skin neoplasm of uncertain behavior, type 1 diabetes nephropathy, vascular dementia, vascular insufficiency of intestine