rs12305347 chr12:130880480 C>G
- Sequence
accatttttcactttgtgtgacgg[C/G]cttttctgtcagtgagttttacag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.32 | 0.69 | 2.03 | |||
| HEK293 (embryonic kidney) | 0.62 | -0.09 | 1.99 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg