rs12318374 chr12:92551780 T>C
- Sequence
acctgcaaaatgagaaggaatctg[T/C]cacacaaaatgtagggagagaggg
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.48 | 0.65 | 1.27 | |||
| K562 (myelogenous leukemia) | 0.47 | -0.06 | 2.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, longstanding arthritis, obesity with early age of onset (age >2), paternal transmission distortion, schizophrenia, sporadic creutzfeldt-jakob disease, total cholesterol