rs12320939 chr12:121624817 G>T
- Sequence
gagttacgtttcaccccgccaacc[G/T]gcaatgtcacatgctcgtcactca
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte CD34+ stem cells-derived erythroblasts BCBL-1 (B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.85 | -0.14 | 2.02 | |||
| foreskin keratinocyte | 0.30 | n/a | 2.50 | |||
| CD34+ stem cells-derived erythroblasts | -3.11 | 2.24 | 2.50 | |||
| BCBL-1 (B-cell lymphoma) | 1.93 | -1.62 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, fasting blood glucose, obesity with early age of onset (age >2), prop taste detection threshold, refractive error, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cortex, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood