rs12328616 chr2:228622290 A>C
- Sequence
gaagttaaaaacaaataatacagg[A/C]cagttttttcagtttagccatttt
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.78 | -2.08 | 1.50 | -6.20 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, ldl cholesterol, panic disorder, parkinsons disease, total cholesterol, waist hip ratio